Table of Contents |
---|
Public small RNA-seq data
...
Code Block |
---|
mkdir -p $HOME/workshop/small_RNAseq/scripts cp /work/training/2024/smallRNAseq/scripts/* $HOME/workshop/small_RNAseq/scripts/ ls -l $HOME/workshop/small_RNAseq/scripts/ |
Line 1: The -p indicates create parental directories as required. Thus the line 1 command creates both /workshop/ and the subfolder /workshop/scripts/
Line 2: Copies all files from /work/training/2024/smallRNAseq/scripts/ as noted by an asterisk to the newly created folder $HOME/workshop/small_RNAseq/scripts/
Line 3: List the files in the script folder
Copy multiple subdirectories and files using rsync
Code Block |
---|
mkdir -p $HOME/workshop/small_RNAseq/data/ rsync -rv /work/training/2024/smallRNAseq/data/ $HOME/workshop/small_RNAseq/data/ |
Line 1: The first command creates the folder /data/
Line 2: rsync copies all subfolders and files from the specified source folder to the selected destination folder. The -r = recursively will copy directories and files; -v = verbose messages of the transfer of files
Create a folder for running the nf-core small RNA-seq pipeline
...
Code Block |
---|
mkdir -p $HOME/workshop/small_RNAseq/run1_test mkdir -p $HOME/workshop/small_RNAseq/run2_smallRNAseq_human cd $HOME/workshop/small_RNAseq/ |
Lines 1-2: create sub-folders for each exercise
Line 3: change the directory to the folder “small_RNAseq”
Exercise 1: Running a test with nf-core sample data
First, let’s assess the execution of the nf-core/smrnaseq pipeline by running a test using sample data.
...
Code Block |
---|
cat launch_nf-core_smallRNAseq_human_test.pbs |
#!/bin/bash -l #PBS -N sRNAseq_test #PBS -l select=1:ncpus=2:mem=4gb #PBS -l walltime=24:00:00 #PBS -m abe cd $PBS_O_WORKDIR #work in current directory (folder) module load java #load java and set up memory settings to run nextflow export NXF_OPTS='-Xms1g -Xmx4g' nextflow run nf-core/smrnaseq -r 2.3.1 \ -profile test,singularity \ --outdir results # run the test |
---|
where:
nextflow command: nextflow run
pipeline name: nf-core/smrnaseq
pipeline version: -r 2.3.1
container type and sample data: -profile test,singularity
output directory: --outdir results
Submitting the job
Now we can submit the small RNAseq test job to the HPC scheduler:
...
Monitoring the Run
Code Block |
---|
qjobs |
Exercise 2: Running the small RNA pipeline using public human data
The pipeline requires preparing at least 2 files:
Metadata file (samplesheet.csv) thatspecifies the “sample name” and “location of FASTQ files” ('Read 1').
PBS Pro script (launch_nf-core_smallRNAseq_human.pbs) with instructions to run the pipeline
How to create the metadata file (samplesheet.csv):
Change to the data folder directory:
...
Code Block |
---|
cp /work/training/smallRNAseq/scripts/create_nf-core_smallRNAseq_samplesheet.sh $HOME/workshop/small_RNAseq/data/human |
Note: you could replace ‘$HOME/workshop/small_RNAseq/data/human’ with “.” A dot indicates ‘current directory’ and will copy the file to the directory where you are currently located
View the content of the script:
Code Block |
---|
cat create_nf-core_smallRNAseq_samplesheet.sh |
#!/bin/bash -l #User defined variables. ########################################################## DIR='$HOME/workshop/small_RNAseq/data/human' INDEX='samplesheet.csv' ########################################################## #load python module module load python/3.10.8-gcccore-12.2.0 #fetch the script to create the sample metadata table wget -L https://raw.githubusercontent.com/nf-core/rnaseq/master/bin/fastq_dir_to_samplesheet.py chmod +x fastq_dir_to_samplesheet.py #generate initial sample metadata file ./fastq_dir_to_samplesheet.py $DIR index.csv \ --strandedness auto \ --read1_extension .fastq.gz #format index file cat index.csv | awk -F "," '{print $1 "," $2}' > ${INDEX} #Remove intermediate files: rm index.csv fastq_dir_to_samplesheet.py |
---|
...
Copy the PBS Pro script for running the full small RNAseq pipeline (launch_nf-core_smallRNAseq_human.pbs)
Copy and paste the code below to the terminal:
Code Block |
---|
cp $HOME/workshop/small_RNAseq/data/human/samplesheet.csv $HOME/workshop/small_RNAseq/run2_smallRNAseq_human cp $HOME/workshop/small_RNAseq/scripts/launch_nf-core_smallRNAseq_human.pbs $HOME/workshop/small_RNAseq/run2_smallRNAseq_human cd $HOME/workshop/small_RNAseq/run2_smallRNAseq_human |
Line 1: Copy the samplesheet.csv file to the working directory
Line 2: Copy the launch_nf-core_smallRNAseq_human.pbs submission script to the working directory
Line 3: Move to the working directory
View the content of the launch_nf-core_RNAseq_QC.pbs
script:
Code Block |
---|
cat launch_nf-core_smallRNAseq_human.pbs |
#!/bin/bash -l #PBS -N sRNAseq_human #PBS -l select=1:ncpus=2:mem=4gb #PBS -l walltime=24:00:00 #PBS -m abe cd $PBS_O_WORKDIR #run the tasks in the current working directory module load java #load java and assign up to 4GB RAM memory for nextflow to use export NXF_OPTS='-Xms1g -Xmx4g' nextflow run nf-core/smrnaseq -r 2.3.1 \ -profile singularity \ --outdir results \ --input samplesheet.csv \ --genome GRCh38-local \ --mirtrace_species hsa \ --three_prime_adapter 'TGGAATTCTCGGGTGCCAAGG' \ --fastp_min_length 18 \ --fastp_max_length 30 \ --hairpin /work/training/smallRNAseq/data/mirbase/hairpin.fa \ --mature /work/training/smallRNAseq/data/mirbase/mature.fa \ --mirna_gtf /work/training/smallRNAseq/data/mirbase/hsa.gff3 \ -resume #run the small RNAseq pipeline |
---|
Submit the job to the HPC cluster:
...
Note: the “mature_counts.csv” needs to be transposed prior running the statistical analysis. This can be done either user the R script or using a script called “transpose_csv.py”.
Let’s initially create a “DESeq2” folder and copy the files needed for the statistical analysis:
...
To transpose the initial “mature_counstcounts.csv” file do the following:
Code Block |
---|
python transpose_csv.py --input mature_counts.csv --out mature_counts.txt |
Differential expression analysis using RStudio
Differential expression analysis for smRNA-Seq is similar to regular RNA-Seq. Since you have already done the step-wise analysis in session 35, in this session we will streamline the analysis by running a single R script.
...
2. Create a working directory
As we discussed in section 3session 5, R requires that you set a working directory, where it automatically looks for input files/data and outputs figures, tables, etc. We’ll need to first create this directory.
a. Open Windows Explorer.
b. Go to: H:\workshop\small_RNAseq
c. Create a new folder here called ‘DESeq2’ (NOTE: R is case-sensitive, so it must be named exactly like this)
...
c. Hit the save button and save this file in the working directory you created above (H:\workshop\small_RNAseq\DESeq2). Name the R script ‘DESeq2.R’.
...
Code Block |
---|
#### 4. Loading required packages #### # This section needs to be run every time # Load packages bioconductor_packages <- c("DESeq2", "EnhancedVolcano") cran_packages <- c("ggrepel", "ggplot2", "plyr", "reshape2", "FactoMineR", "factoextra", "pheatmap") lapply(cran_packages, require, character.only = TRUE) lapply(bioconductor_packages, require, character.only = TRUE) #### 5. Import your count data #### # Set working directory. # Change this to your working directory # Set your home working directory # NOTE: # Working directory - setwd("H:/workshop/small_RNAseq/DESeq2") # Import your count data. make sure you've created a 'data' subdirectory and put the count table file there. metacounts <- read.csv("W:/training/smallRNAseq/runs/run2_smallRNAseq_human/results/edger/mature_counts.csv", header = TRUE, row.names = 1) # Count table needs to be transposed and converted to a data frame metacounts <- as.data.frame(t(metacounts)) # Import metadata. Again, need a metadata_microRNA.txt file in the data subdirectory. meta <- read.table("W:/training/smallRNAseq/runs/run2_smallRNAseq_human/results/edger/metadata_microRNA.txt", header = TRUE) # Rename sample names to new sample IDs counts <- metacounts[as.character(meta$sample_name)] colnames(counts) <- meta$sample_ID #### 6. Outliers and batch effects #### # This section normalises and transforms the count data so that it can be plotted on a PCA plot and a heatmap ## USER INPUT # Choose the groups you want to plot in a PCA/Heatmap. You can select any 2 or more of the groups (or all of the groups) you have in your 'groups' column of your metadata table # To see what groups are present, run the following: unique(meta$group) # Now add which groups you want to plot (i.e. replace the groupnames below, and add more, separated by a comma and in "quotes", as needed). NOTE: R is case-sensitive, so these group names must be named EXACTLY the same as in the metadata table. plotgroups <- c("normal", "Huntingtons_disease") # Pull out only the counts from the above groups groupcounts <- counts[meta$group %in% plotgroups] # Normalise counts by library size, using DeSeq2's estimateSizeFactors() function. Note that DeSeq2 does this internally during DEG calling. The normalisation below is done separately for PCA and density plotting. # Set up the initial DeSeq2 experimental parameters. condition <- factor(1:length(groupcounts)) # Set up the column data. A data frame of sample ID's and conditions coldata <- data.frame(row.names=colnames(groupcounts), condition) # Set up the DeSeq2 data set structure f <- DESeqDataSetFromMatrix(countData = groupcounts, colData = coldata, design= ~ condition) # Estimate the size factors. See DeSeq2 manual for details f <- estimateSizeFactors(f) # Size factors can be viewed by: sizeFactors(f) # Multiply each row (sample) by the corresponding size factor subcount_norm <- as.matrix(groupcounts) %*% diag(sizeFactors(f)) # Re-add column names colnames(subcount_norm) <- colnames(groupcounts) ## Remove low coverage transcripts (mean count < 10) ## # Find the mean of each row (and output as a data frame object) means <- as.data.frame(rowMeans(subcount_norm)) # Then join the means data with the counts means <- cbind(means, subcount_norm) # Then subset out only genes with mean > 10 data <- subset(means, means[ , 1] > 10) # Remove the means column data <- data[,-1] # Transform data data_log <- vst(round(as.matrix(data)), nsub = nrow(data)-20) # Transformation can create some infinite values. Can't generate PCA data on these. Can see how many by: sum(sapply(data_log, is.infinite)) # To remove infinite rows, use 'is.finte' or '!is.infinite' data_log <- data_log[is.finite(rowSums(data_log)),] colnames(data_log) <- colnames(groupcounts) ### Set up the PCA plot base data ### # We're using the FactoMineR package to generate PCA plots (http://factominer.free.fr/index.html) # Need to transpose the data first data_log_t <- t(data_log) # Add the group data data_log_t_vars <- data.frame(meta$group[meta$group %in% plotgroups], data_log_t) # Generate the PCA data using FactoMineR package res.pca <- PCA(data_log_t_vars, quali.sup = 1, graph=FALSE) ## Set up the dendogram/heatmaps base data ## # Calculate the distance matrix: distance_matrix <- as.matrix(dist(t(data_log))) #### 6a. PCA plot #### # Generate the PCA plot. Groups are shaded with ellipses at 95% confidence level. NOTE: at least 4 replicates need to be in a group for an ellipses to be drawn. # NOTE: change the group point colours by changing 'palette = ' below. Use the 'RColourBrewer' colour names (https://r-graph-gallery.com/38-rcolorbrewers-palettes.html). For example, if you are plotting 3 groups and choose palette = "Set1", this will use the first 3 colours from the Set1 colour palette. p <- fviz_pca_ind(res.pca, geom.ind = c("point", "text"), # show points only (but not "text") col.ind = meta$group[meta$group %in% plotgroups], # color by groups pointsize = 5, label = "all", title = "", legend.title = "Treatment groups", palette = "Dark2", addEllipses = TRUE, ellipse.type = "t", ellipse.level = 0.95) + theme(legend.text = element_text(size = 12), legend.title = element_text(size = 14), axis.title=element_text(size=16), axis.text=element_text(size=14)) p # Output as publication quality (300dpi) tiff and pdf. # This will name your output files with the treatment groups you selected. # Create a 'results_outliers_included' subdirectory where all results_outliers_included will be output dir.create("results_outliers_included", showWarnings = FALSE) # Create a (300dpi) tiff ggsave(file = paste0("./results_outliers_included/PCA_", paste(plotgroups, collapse = "_Vs_"), ".tiff"), dpi = 300, compression = "lzw", device = "tiff", width = 10, height = 8, plot = p) # Create a pdf ggsave(file = paste0("./results_outliers_included/PCA_", paste(plotgroups, collapse = "_Vs_"), ".pdf"), device = "pdf", width = 10, height = 8, plot = p) #### 6b. Samples heatmap and dendrogram #### # This section plots a heatmap and dendrogram of pairwise relationships between samples. In this way you can see if samples cluster by treatment group. # See here: https://davetang.org/muse/2018/05/15/making-a-heatmap-in-r-with-the-pheatmap-package/ # Define annotation column annot_columns <- data.frame(meta$group[meta$group %in% plotgroups]) # Make the row names the sample IDs row.names(annot_columns) <- meta$sample_ID[meta$group %in% plotgroups] colnames(annot_columns) <- "Treatment groups" # Need to factorise it annot_columns[[1]] <- factor(annot_columns[[1]]) # Generate dendrogram and heatmap pheatmap(distance_matrix, color=colorRampPalette(c("white", "#9999FF", "#990000"))(50), cluster_rows = TRUE, show_rownames = TRUE, treeheight_row = 0, treeheight_col = 70, fontsize_col = 12, annotation_names_col = F, annotation_col = annot_columns, filename = paste0("./results_outliers_included/Pairwise_sample_heatmap_", paste(plotgroups, collapse = "_Vs_"), ".tiff")) # Notes about heatmap colours. # You can change the colours used in the heatmap itself by changing the colour names (color=colorRampPalette....) # If you want to change the annotation colours, see here: https://zhiganglu.com/post/pheatmap_change_annotation_colors/ #### 7. Differential expression analysis #### # In this section we use the Deseq2 package to identify differentially expressed genes. ## USER INPUT # Choose the treatment groups you want to compare. # To see what groups are present, run the following: unique(meta$group) # Enter which groups you want to compare (two groups only). BASELINE OR CONTROL GROUP SHOULD BE LISTED FIRST. degroups <- c("normal", "Huntingtons_disease") # From the count table, pull out only the counts from the above groups expdata <- as.matrix(counts[,meta$group %in% degroups]) # Set up the experimental condition # 'factor' sets up the reference level, i.e. which is the baseline group (otherwise the default baseline level is in alphabetic order) condition <- factor(meta$group[meta$group %in% degroups], levels = degroups) # Type 'condition' in the console to see is the levels are set correctly # Set up column data (treatment groups and sample ID) coldata <- data.frame(row.names=colnames(expdata), condition) # Create the DESeq2 dataset (dds) dds <- DESeq2::DESeqDataSetFromMatrix(countData=expdata, colData=coldata, design=~condition) dds$condition <- factor(dds$condition, levels = degroups) # Run DESeq2 to identify differentially expressed genes deseq <- DESeq(dds) # Extract a results table from the DESeq analysis res <- results(deseq) # Reorder results by adjusted p vales, so that the most signififcantly DE genes are at the top res <- res[order(res$padj), ] # You can do a summary of the results to see how many significantly (alpha=0.05, adjust to 0.01 if needed) upregulated and downregulated DE genes were found summary(res, alpha=0.05) # Convert from DESeq object to a data frame. res <- data.frame(res) # Look at the top 6 DE genes head(res) # Add normalised counts to the output table. This is so you can later plot expression trends for individual genes in R, Excel, etc. # Need to normalise the counts first, using the size factors calculated by DESeq2 (in the 'deseq' object) expdata_norm <- as.matrix(expdata) %*% diag(deseq$sizeFactor) colnames(expdata_norm) <- colnames(expdata) annot_counts <- merge(x = res, y = expdata_norm, by = 0, all = TRUE) # Pull out just significant genes (change from 0.05 to 0.01 if needed) DE_genes <- subset(annot_counts, padj < 0.05, select=colnames(annot_counts)) # Export as a csv table write.csv(DE_genes, file=paste0("./results_outliers_included/DE_genes_", paste(degroups, collapse = "_Vs_"), ".csv"), row.names = FALSE) #### 7b. Volcano plot #### p <- EnhancedVolcano(res, lab = row.names(res), selectLab = row.names(res)[1:20], drawConnectors = TRUE, title = NULL, subtitle = NULL, x = 'log2FoldChange', y = 'pvalue') p <- EnhancedVolcano(res, lab = rownames(res), pointSize = 3, drawConnectors = TRUE, title = NULL, subtitle = NULL, x = 'log2FoldChange', y = 'pvalue') p # NOTE: the above plot shows labels for the top significantly DE (i.e. by lowest adjusted p value) genes. # Output as publication quality (300dpi) tiff and pdf. # Create a (300dpi) tiff ggsave(file = paste0("./results_outliers_included/volcano_", paste(degroups, collapse = "_Vs_"), ".tiff"), dpi = 300, compression = "lzw", device = "tiff", width = 10, height = 8, plot = p) # Create a pdf ggsave(file = paste0("./results_outliers_included/volcano_", paste(degroups, collapse = "_Vs_"), ".pdf"), device = "pdf", width = 10, height = 8, plot = p) #### 7c. DE genes heatmaps and dendrograms #### # sort by p-value DE_genes <- DE_genes[order(DE_genes$padj), ] row.names(DE_genes) <- DE_genes$Row.names # Pull out normalised counts only siggc <- DE_genes[colnames(DE_genes) %in% colnames(expdata)] # Scale and center each row. This is important to visualise relative differences between groups and not have row-wise colouration dominated by high or low gene expression. xts <- scale(t(siggc)) xtst <- t(xts) # Define annotation column annot_columns <- data.frame(meta$group[meta$group %in% degroups]) # Make the row names the sample IDs row.names(annot_columns) <- meta$sample_ID[meta$group %in% degroups] colnames(annot_columns) <- "Treatment groups" # Need to factorise it annot_columns[[1]] <- factor(annot_columns[[1]]) # Generate dendrogram and heatmap for ALL DE genes pheatmap(xtst, color=colorRampPalette(c("#D55E00", "white", "#0072B2"))(100), annotation_col=annot_columns, annotation_names_col = F, fontsize_col = 12, fontsize_row = 7, labels_row = row.names(siggc), show_rownames = T, filename = paste0("./results_outliers_included/All_DEG_Heatmap_", paste(plotgroups, collapse = "_Vs_"), ".tiff")) #### OUTLIER REMOVAL #### # This section repeats the above, but removes outliers first # REMOVE OUTLIERS FROM METADATA TABLE AN COUNT TABLE. meta <- meta[- grep(c("WT4"), meta$sample_ID),] counts <- counts[- grep(c("WT4"), colnames(counts))] #### 8. Outliers and batch effects #### # This section normalises and transforms the count data so that it can be plotted on a PCA plot and a heatmap ## USER INPUT # Choose the groups you want to plot in a PCA/Heatmap. You can select any 2 or more of the groups (or all of the groups) you have in your 'groups' column of your metadata table # To see what groups are present, run the following: unique(meta$group) # Now add which groups you want to plot (i.e. replace the groupnames below, and add more, separated by a comma and in "quotes", as needed). NOTE: R is case-sensitive, so these group names must be named EXACTLY the same as in the metadata table. plotgroups <- c("normal", "Huntingtons_disease") # Pull out only the counts from the above groups groupcounts <- counts[meta$group %in% plotgroups] # Normalise counts by library size, using DeSeq2's estimateSizeFactors() function. Note that DeSeq2 does this internally during DEG calling. The normalisation below is done separately for PCA and density plotting. # Set up the initial DeSeq2 experimental parameters. condition <- factor(1:length(groupcounts)) # Set up the column data. A data frame of sample ID's and conditions coldata <- data.frame(row.names=colnames(groupcounts), condition) # Set up the DeSeq2 data set structure f <- DESeqDataSetFromMatrix(countData = groupcounts, colData = coldata, design= ~ condition) # Estimate the size factors. See DeSeq2 manual for details f <- estimateSizeFactors(f) # Size factors can be viewed by: sizeFactors(f) # Multiply each row (sample) by the corresponding size factor subcount_norm <- as.matrix(groupcounts) %*% diag(sizeFactors(f)) # Re-add column names colnames(subcount_norm) <- colnames(groupcounts) ## Remove low coverage transcripts (mean count < 10) ## # Find the mean of each row (and output as a data frame object) means <- as.data.frame(rowMeans(subcount_norm)) # Then join the means data with the counts means <- cbind(means, subcount_norm) # Then subset out only genes with mean > 10 data <- subset(means, means[ , 1] > 10) # Remove the means column data <- data[,-1] # Transform data data_log <- vst(round(as.matrix(data)), nsub = nrow(data)-20) # Transformation can create some infinite values. Can't generate PCA data on these. Can see how many by: sum(sapply(data_log, is.infinite)) # To remove infinite rows, use 'is.finte' or '!is.infinite' data_log <- data_log[is.finite(rowSums(data_log)),] colnames(data_log) <- colnames(groupcounts) ### Set up the PCA plot base data ### # We're using the FactoMineR package to generate PCA plots (http://factominer.free.fr/index.html) # Need to transpose the data first data_log_t <- t(data_log) # Add the group data data_log_t_vars <- data.frame(meta$group[meta$group %in% plotgroups], data_log_t) # Generate the PCA data using FactoMineR package res.pca <- PCA(data_log_t_vars, quali.sup = 1, graph=FALSE) ## Set up the dendogram/heatmaps base data ## # Calculate the distance matrix: distance_matrix <- as.matrix(dist(t(data_log))) #### 8a. PCA plot #### # Generate the PCA plot. Groups are shaded with ellipses at 95% confidence level. NOTE: at least 4 replicates need to be in a group for an ellipses to be drawn. # NOTE: change the group point colours by changing 'palette = ' below. Use the 'RColourBrewer' colour names (https://r-graph-gallery.com/38-rcolorbrewers-palettes.html). For example, if you are plotting 3 groups and choose palette = "Set1", this will use the first 3 colours from the Set1 colour palette. p <- fviz_pca_ind(res.pca, geom.ind = c("point", "text"), # show points only (but not "text") col.ind = meta$group[meta$group %in% plotgroups], # color by groups pointsize = 5, label = "all", title = "", legend.title = "Treatment groups", palette = "Dark2", addEllipses = TRUE, ellipse.type = "t", ellipse.level = 0.95) + theme(legend.text = element_text(size = 12), legend.title = element_text(size = 14), axis.title=element_text(size=16), axis.text=element_text(size=14)) p # Output as publication quality (300dpi) tiff and pdf. # This will name your output files with the treatment groups you selected. # Create a 'results_outliers_removed' subdirectory where all results_outliers_removed will be output dir.create("results_outliers_removed", showWarnings = FALSE) # Create a (300dpi) tiff ggsave(file = paste0("./results_outliers_removed/PCA_", paste(plotgroups, collapse = "_Vs_"), ".tiff"), dpi = 300, compression = "lzw", device = "tiff", width = 10, height = 8, plot = p) # Create a pdf ggsave(file = paste0("./results_outliers_removed/PCA_", paste(plotgroups, collapse = "_Vs_"), ".pdf"), device = "pdf", width = 10, height = 8, plot = p) #### 8b. Samples heatmap and dendrogram #### # This section plots a heatmap and dendrogram of pairwise relationships between samples. In this way you can see if samples cluster by treatment group. # See here: https://davetang.org/muse/2018/05/15/making-a-heatmap-in-r-with-the-pheatmap-package/ # Define annotation column annot_columns <- data.frame(meta$group[meta$group %in% plotgroups]) # Make the row names the sample IDs row.names(annot_columns) <- meta$sample_ID[meta$group %in% plotgroups] colnames(annot_columns) <- "Treatment groups" # Need to factorise it annot_columns[[1]] <- factor(annot_columns[[1]]) # Generate dendrogram and heatmap pheatmap(distance_matrix, color=colorRampPalette(c("white", "#9999FF", "#990000"))(50), cluster_rows = TRUE, show_rownames = TRUE, treeheight_row = 0, treeheight_col = 70, fontsize_col = 12, annotation_names_col = F, annotation_col = annot_columns, filename = paste0("./results_outliers_removed/Pairwise_sample_heatmap_", paste(plotgroups, collapse = "_Vs_"), ".tiff")) # Notes about heatmap colours. # You can change the colours used in the heatmap itself by changing the colour names (color=colorRampPalette....) # If you want to change the annotation colours, see here: https://zhiganglu.com/post/pheatmap_change_annotation_colors/ #### 9. Differential expression analysis #### # In this section we use the Deseq2 package to identify differentially expressed genes. ## USER INPUT # Choose the treatment groups you want to compare. # To see what groups are present, run the following: unique(meta$group) # Enter which groups you want to compare (two groups only). BASELINE OR CONTROL GROUP SHOULD BE LISTED FIRST. degroups <- c("normal", "Huntingtons_disease") # From the count table, pull out only the counts from the above groups expdata <- as.matrix(counts[,meta$group %in% degroups]) # Set up the experimental condition # 'factor' sets up the reference level, i.e. which is the baseline group (otherwise the default baseline level is in alphabetic order) condition <- factor(meta$group[meta$group %in% degroups], levels = degroups) # Type 'condition' in the console to see is the levels are set correctly # Set up column data (treatment groups and sample ID) coldata <- data.frame(row.names=colnames(expdata), condition) # Create the DESeq2 dataset (dds) dds <- DESeq2::DESeqDataSetFromMatrix(countData=expdata, colData=coldata, design=~condition) dds$condition <- factor(dds$condition, levels = degroups) # Run DESeq2 to identify differentially expressed genes deseq <- DESeq(dds) # Extract a results table from the DESeq analysis res <- results(deseq) # Reorder results by adjusted p vales, so that the most signififcantly DE genes are at the top res <- res[order(res$padj), ] # You can do a summary of the results to see how many significantly (alpha=0.05, adjust to 0.01 if needed) upregulated and downregulated DE genes were found summary(res, alpha=0.05) # Convert from DESeq object to a data frame. res <- data.frame(res) # Look at the top 6 DE genes head(res) # Add normalised counts to the output table. This is so you can later plot expression trends for individual genes in R, Excel, etc. # Need to normalise the counts first, using the size factors calculated by DESeq2 (in the 'deseq' object) expdata_norm <- as.matrix(expdata) %*% diag(deseq$sizeFactor) colnames(expdata_norm) <- colnames(expdata) annot_counts <- merge(x = res, y = expdata_norm, by = 0, all = TRUE) # Pull out just significant genes (change from 0.05 to 0.01 if needed) DE_genes <- subset(annot_counts, padj < 0.05, select=colnames(annot_counts)) # Export as a csv table write.csv(DE_genes, file=paste0("./results_outliers_removed/DE_genes_", paste(degroups, collapse = "_Vs_"), ".csv"), row.names = FALSE) #### 9b. Volcano plot #### p <- EnhancedVolcano(res, lab = row.names(res), selectLab = row.names(res)[1:20], drawConnectors = TRUE, title = NULL, subtitle = NULL, x = 'log2FoldChange', y = 'pvalue') p <- EnhancedVolcano(res, lab = rownames(res), pointSize = 3, drawConnectors = TRUE, title = NULL, subtitle = NULL, x = 'log2FoldChange', y = 'pvalue') p # NOTE: the above plot shows labels for the top significantly DE (i.e. by lowest adjusted p value) genes. # Output as publication quality (300dpi) tiff and pdf. # Create a (300dpi) tiff ggsave(file = paste0("./results_outliers_removed/volcano_", paste(degroups, collapse = "_Vs_"), ".tiff"), dpi = 300, compression = "lzw", device = "tiff", width = 10, height = 8, plot = p) # Create a pdf ggsave(file = paste0("./results_outliers_removed/volcano_", paste(degroups, collapse = "_Vs_"), ".pdf"), device = "pdf", width = 10, height = 8, plot = p) #### 9c. DE genes heatmaps and dendrograms #### # sort by p-value DE_genes <- DE_genes[order(DE_genes$padj), ] row.names(DE_genes) <- DE_genes$Row.names # Pull out normalised counts only siggc <- DE_genes[colnames(DE_genes) %in% colnames(expdata)] # Scale and center each row. This is important to visualise relative differences between groups and not have row-wise colouration dominated by high or low gene expression. xts <- scale(t(siggc)) xtst <- t(xts) # Define annotation column annot_columns <- data.frame(meta$group[meta$group %in% degroups]) # Make the row names the sample IDs row.names(annot_columns) <- meta$sample_ID[meta$group %in% degroups] colnames(annot_columns) <- "Treatment groups" # Need to factorise it annot_columns[[1]] <- factor(annot_columns[[1]]) # Generate dendrogram and heatmap for ALL DE genes pheatmap(xtst, color=colorRampPalette(c("#D55E00", "white", "#0072B2"))(100), annotation_col=annot_columns, annotation_names_col = F, fontsize_col = 12, fontsize_row = 7, labels_row = row.names(siggc), show_rownames = T, filename = paste0("./results_outliers_removed/All_DEG_Heatmap_", paste(plotgroups, collapse = "_Vs_"), ".tiff")) |
Running R Scripts on the HPC
...
Using R Studio, create a Text File and paste in the contents of this script.
Save it as launch_R.pbs in H:\workshop\small_RNAseq\DESeq2 (Same folder as DESeq2.R (Remember, H: is pointed at your HPC Home Folder.
...