Page Comparison

Overview

Create a metadata “samplesheet.csv” for small RNAseq datasets.
Learn to use a “nextflow.config” file in the working directory to override Nextflow parameters (e.g., specify where to find the pipeline assets).
Learn how to prepare a PBS script to run the expression profiling of small RNAs against the reference miRBase database annotated microRNAs.

Preparing the pipeline inputs

The pipeline requires preparing at least 2 files:

Metadata file (samplesheet.csv) thatspecifies the name of the samples, location of FASTQ files ('Read 1' and ‘Read 2’), and strandedness (forward, reverse, or auto. Note: auto is used when the strandedness of the data is unknown)
PBS Pro script (launch_nf-core_RNAseq_QC.pbs) with instructions to run the pipeline
Nextflow.config - revision 2.3.1 of the nf-core/smrnaseq pipeline may not be able to identify the location of reference adapter sequences, thus, we will use a local nextflow.config file to tell Nextflow where to find the reference adapters necessary to trim the raw small_RNA-Seq data

A. Create the metadata file (samplesheet.csv):

Change to the data folder directory:

...

Code Block
cp /work/training/2024/smallRNAseq/scripts/create_nf-core_smallRNAseq_samplesheet.sh $HOME/workshop/2024-2/session6_smallRNAseq/data/human_disease

Note: you could replace ‘$HOME/workshop/data’ with “.” A dot indicates ‘current directory’ and will copy the file to the directory where you are currently located

View the content of the script:

Code Block
cat create_nf-core_smallRNAseq_samplesheet.sh

...

NOTE: modify ‘read1_extension’ as appropriate for your data. For example: _1.fastq.gz or _R1_001.fastq.gz or _R1.fq.gz , etc

Let’s generate the metadata file by running the following command:

...

Copy the PBS Pro script for running the full small RNAseq pipeline (launch_nf-core_smallRNAseq_miRBase.pbs)

Copy and paste the code below to the terminal:

Code Block

cp $HOME/workshop/2024-2/session6_smallRNAseq/data/human_disease/samplesheet.csv $HOME/workshop/2024-2/session6_smallRNAseq/runs/run1_human_miRBase
cp /work/training/2024/smallRNAseq/scripts/launch_nf-core_smallRNAseq_miRBase.pbs $HOME/workshop/2024-2/session6_smallRNAseq/runs/run1_human_miRBase
cp /work/training/2024/smallRNAseq/scripts/nextflow.config $HOME/workshop/2024-2/session6_smallRNAseq/runs/run1_human_miRBase
cd $HOME/workshop/2024-2/session6_smallRNAseq/runs/run1_human_miRBase

Line 1: Copy the samplesheet.csv file to the working directory
Line 2: Copy the launch_nf-core_smallRNAseq_human.pbs submission script to the working directory
Line 3: Copy the nextflow.config file from shared folder to my working directory.
Line 4: move to the working directory

View the content of the launch_nf-core_RNAseq_QC.pbs script:

...

TIP: when running the nf-core/smrnaseq pipeline (release 2.3.1) the pipeline is not able to find the location of the reference adapter sequences for trimming of the raw small RNAseq pipeline, so we need to specify where to find the folder where the adapter sequences file is located. To do this, we prepare a “nextflow.config” file (see below). This file should be already in your working directory. Print the content as follows:

Code Block
cat nextflow.config

Code Block
singularity { runOptions = '-B $HOME/.nextflow/assets/nf-core/smrnaseq/assets' }

Note: if a config file is placed in the working folder it can override parameters define by the global ~/.nextflow/config file or the config file define as part of the pipeline.

Submit the job to the HPC cluster:

...

Code Block
mkdir -p $HOME/workshop/small_RNAseq/scripts cp /work/training/smallRNAseq/scripts/* $HOME/workshop/small_RNAseq/scripts/ ls -l $HOME/workshop/small_RNAseq/scripts/

Line 1: The -p indicates create 'parental directories as required. Thus the line 1 command creates both /workshop/ and the subfolder /workshop/scripts/
Line 2: Copies all files from /work/datasets/workshop/scripts/ as noted by an asterisk to the newly created folder $HOME/workshop/scripts/
Line 3: List the files in the script folder

Copy multiple subdirectories and files using rsync

Code Block
mkdir -p $HOME/workshop/small_RNAseq/data/ rsync -rv /work/training/smallRNAseq/data/ $HOME/workshop/small_RNAseq/data/

Line 1: The first command creates the folder /scripts/
Line 2: rsync copies all subfolders and files from the specified source folder to the selected destination folder. The -r = recursively will copy directories and files; -v = verbose messages of the transfer of files

Create a folder for running the nf-core small RNA-seq pipeline

...

Code Block
mkdir -p $HOME/workshop/small_RNAseq mkdir $HOME/workshop/small_RNAseq/run1_test mkdir $HOME/workshop/small_RNAseq/run2_smallRNAseq_human cd $HOME/workshop/small_RNAseq/

Lines 1-4: create sub-folders for each exercise
Line 5: change the directory to the folder “small_RNAseq”

Exercise 1: Running a test with nf-core sample data

First, let’s assess the execution of the nf-core/rnaseq pipeline by running a test using sample data.

...

Code Block
cat launch_nf-core_smallRNAseq_test.pbs

#!/bin/bash -l

#PBS -N nfsmrnaseq

#PBS -l select=1:ncpus=2:mem=4gb

#PBS -l walltime=24:00:00

#work on current directory (folder)

cd $PBS_O_WORKDIR

#load java and set up memory settings to run nextflow

module load java

export NXF_OPTS='-Xms1g -Xmx4g'

# run the test

nextflow run nf-core/smrnaseq -profile test,singularity --outdir results -r 2.1.0

where:

nextflow command: nextflow run
pipeline name: nf-core/smrnaseq
pipeline version: -r 2.1.0
container type and sample data: -profile test,singularity
output directory: --outdir results

Submitting the job

Now we can submit the small RNAseq test job to the HPC scheduler:

...

Monitoring the Run

Code Block
qjobs

Exercise 2: Running the small RNA pipeline using public human data

The pipeline requires preparing at least 2 files:

Metadata file (samplesheet.csv) thatspecifies the “sample name” and “location of FASTQ files” ('Read 1').
PBS Pro script (launch_nf-core_smallRNAseq_human.pbs) with instructions to run the pipeline

Create the metadata file (samplesheet.csv):

Change to the data folder directory:

...

Code Block
cp /work/training/smallRNAseq/scripts/create_nf-core_smallRNAseq_samplesheet.sh $HOME/workshop/small_RNAseq/data/human

Note: you could replace ‘$HOME/workshop/data’ with “.” A dot indicates ‘current directory’ and will copy the file to the directory where you are currently located

View the content of the script:

Code Block
cat create_nf-core_smallRNAseq_samplesheet.sh

#!/bin/bash -l

#User defined variables.

##########################################################

DIR='$HOME/workshop/small_RNAseq/data/human'

INDEX='samplesheet.csv'

##########################################################

#load python module

module load python/3.10.8-gcccore-12.2.0

#fetch the script to create the sample metadata table

wget -L https://raw.githubusercontent.com/nf-core/rnaseq/master/bin/fastq_dir_to_samplesheet.py

chmod +x fastq_dir_to_samplesheet.py

#generate initial sample metadata file

./fastq_dir_to_samplesheet.py $DIR index.csv \

--strandedness auto \

--read1_extension .fastq.gz

#format index file

cat index.csv | awk -F "," '{print $1 "," $2}' > ${INDEX}

#Remove intermediate files:

rm index.csv fastq_dir_to_samplesheet.py

...

Copy the PBS Pro script for running the full small RNAseq pipeline (launch_nf-core_smallRNAseq_human.pbs)

Copy and paste the code below to the terminal:

Code Block

cp $HOME/workshop/small_RNAseq/data/human/samplesheet.csv $HOME/workshop/small_RNAseq/run2_smallRNAseq_human
cp $HOME/workshop/small_RNAseq/scripts/launch_nf-core_smallRNAseq_human.pbs $HOME/workshop/small_RNAseq/run2_smallRNAseq_human
cd $HOME/workshop/small_RNAseq/run2_smallRNAseq_human

Line 1: Copy the samplesheet.csv file to the working directory
Line 2: copy the launch_nf-core_smallRNAseq_human.pbs submission script to the working directory
Line 3: move to the working directory

View the content of the launch_nf-core_RNAseq_QC.pbs script:

Code Block
cat launch_nf-core_smallRNAseq_human.pbs

#!/bin/bash -l

#PBS -N nfsmallRNAseq

#PBS -l select=1:ncpus=2:mem=4gb

#PBS -l walltime=24:00:00

#PBS -m abe

#run the tasks in the current working directory

cd $PBS_O_WORKDIR

#load java and assign up to 4GB RAM memory for nextflow to use

module load java

export NXF_OPTS='-Xms1g -Xmx4g'

#run the small RNAseq pipeline

nextflow run nf-core/smrnaseq -r 2.1.0 \

-profile singularity \

--outdir results \

--input samplesheet.csv \

--genome GRCh38-local \

--mirtrace_species hsa \

--three_prime_adapter 'TGGAATTCTCGGGTGCCAAGG' \

--fastp_min_length 18 \

--fastp_max_length 30 \

--hairpin /work/training/smallRNAseq/data/mirbase/hairpin.fa \

--mature /work/training/smallRNAseq/data/mirbase/mature.fa \

--mirna_gtf /work/training/smallRNAseq/data/mirbase/hsa.gff3 \

-resume

...

Note: the “mature_counts.csv” needs to be transposed prior running the statistical analysis. This can be done either user the R script or using a script called “transpose_csv.py”.

Let’s initially create a “DESeq2” folder and copy the files needed for the statistical analysis:

...

Versions Compared

Old Version 18

New Version 19

Key

Overview

Preparing the pipeline inputs

A. Create the metadata file (samplesheet.csv):

Exercise 1: Running a test with nf-core sample data

Submitting the job

Monitoring the Run

Exercise 2: Running the small RNA pipeline using public human data

Create the metadata file (samplesheet.csv):