Aim:
This page provides tips on how to cluster oligonucleotide sequences (i.e., aptamers, miRNAs, etc) based on their sequence identity using two strategies: 1) mapper.pl script from the mirdeep2 package, and 2) cd-hit clustering approach.
...
Once installed you will be able to access the mapper.pl script. This script will be used to merge merges sequences that are 100% identical sequences and generate their also generates the copy count for each unique sequence (i.e., seq1_x578 ; seq1 has 578 copies). The available parameters options are:
| Code Block |
|---|
mapper.pl --help
No config or reads file could be found
/Users/barrero/anaconda3/bin/mapper.pl input_file_reads
This script takes as input a file with deep sequencing reads (these can be in
different formats, see the options below). The script then processes the reads
and/or maps them to the reference genome, as designated by the options given.
Options:
Read input file:
-a input file is seq.txt format
-b input file is qseq.txt format
-c input file is fasta format
-e input file is fastq format
-d input file is a config file (see miRDeep2 documentation).
options -a, -b, -c or -e must be given with option -d.
Preprocessing/mapping:
-g three-letter prefix for reads (by default 'seq')
-h parse to fasta format
-i convert rna to dna alphabet (to map against genome)
-j remove all entries that have a sequence that contains letters
other than a,c,g,t,u,n,A,C,G,T,U,N
-k seq clip 3' adapter sequence
-l int discard reads shorter than int nts, default = 18
-m collapse reads
-p genome map to genome (must be indexed by bowtie-build). The 'genome'
string must be the prefix of the bowtie index. For instance, if
the first indexed file is called 'h_sapiens_37_asm.1.ebwt' then
the prefix is 'h_sapiens_37_asm'.
-q map with one mismatch in the seed (mapping takes longer)
-r int a read is allowed to map up to this number of positions in the genome
default is 5
Output files:
-s file print processed reads to this file
-t file print read mappings to this file
Other:
-u do not remove directory with temporary files
-v outputs progress report
-n overwrite existing files
-o number of threads to use for bowtie
Example of use:
/Users/barrero$HOME/anaconda3/bin/mapper.pl reads_seq.txt -a -h -i -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p h_sapiens_37_asm -s reads.fa -t reads_vs_genome.arf -v
|
...
| Code Block |
|---|
mapper.pl S32_19to21nt.rename.fasta -c -m -s S32_19to21nt.collapsed.fa |
Where:
-c input is a fasta file (see above for other input options)
-m merge identical sequences and generate its copy number
-s output filename
Example: Merged identical sequences showing copy number (i.e., _x57828)
...