/
Merging oligonucleotide sequences (local, HPC)

Merging oligonucleotide sequences (local, HPC)

Aim:

This page provides tips on how to cluster oligonucleotide sequences (i.e., aptamers, miRNAs, etc) based on their sequence identity using two strategies: 1) mapper.pl script from the mirdeep2 package, and 2) cd-hit clustering approach.

Pre-requisites

Method 1: Clustering oligonucleotide sequences (i.e., aptamers, miRNAs or small RNAs)

Install the mirdeep2 package using conda

conda install -c bioconda mirdeep2

Once installed you will be able to access the mapper.pl script. This script merges sequences that are 100% identical and also generates the copy count for each unique sequence (i.e., seq1_x578 ; seq1 has 578 copies). The available parameters options are:

mapper.pl --help No config or reads file could be found /Users/barrero/anaconda3/bin/mapper.pl input_file_reads This script takes as input a file with deep sequencing reads (these can be in different formats, see the options below). The script then processes the reads and/or maps them to the reference genome, as designated by the options given. Options: Read input file: -a input file is seq.txt format -b input file is qseq.txt format -c input file is fasta format -e input file is fastq format -d input file is a config file (see miRDeep2 documentation). options -a, -b, -c or -e must be given with option -d. Preprocessing/mapping: -g three-letter prefix for reads (by default 'seq') -h parse to fasta format -i convert rna to dna alphabet (to map against genome) -j remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N -k seq clip 3' adapter sequence -l int discard reads shorter than int nts, default = 18 -m collapse reads -p genome map to genome (must be indexed by bowtie-build). The 'genome' string must be the prefix of the bowtie index. For instance, if the first indexed file is called 'h_sapiens_37_asm.1.ebwt' then the prefix is 'h_sapiens_37_asm'. -q map with one mismatch in the seed (mapping takes longer) -r int a read is allowed to map up to this number of positions in the genome default is 5 Output files: -s file print processed reads to this file -t file print read mappings to this file Other: -u do not remove directory with temporary files -v outputs progress report -n overwrite existing files -o number of threads to use for bowtie Example of use: $HOME/anaconda3/bin/mapper.pl reads_seq.txt -a -h -i -j -k TCGTATGCCGTCTTCTGCTTGT -l 18 -m -p h_sapiens_37_asm -s reads.fa -t reads_vs_genome.arf -v

Merging and collapsing identical sequences using mapper.pl.

mapper.pl S32_19to21nt.rename.fasta -c -m -s S32_19to21nt.collapsed.fa

Where:

-c input is a fasta file (see above for other input options)

-m merge identical sequences and generate its copy number

-s output filename

 

Example: Merged identical sequences showing copy number (i.e., _x57828)

Method 2: cd-hit clustering

Install cd-hit using conda as follows:

Main parameters to be used are the following:

For additional information on other parameters options check man page as follows:

Running cd-hit

where:

-i input fasta file

-o output of cd-hit clusters (i.e, representative consensus)

-c identity thresholds for merging (i.e., -c 1.0 = 100% ; -c 0.90 = 90%)

Running jobs on the HPC

QUT’s HPC uses the PBS Pro scheduler to submit jobs to compute nodes.

Prepare a PBS Pro submission script (i.e, launch.pbs) to submit a job to the HPC. For example:

Where:

#PBS -N name of the job. It can be any name (i.e., script name, tool name, etc)

#PBS -l select=1:ncpus=2:mem=4gb this tells the system that 2 CPUs and 4GB of memory will be used. Modify as appropriate. Note- the more CPUs and MEM you request the longer the job can take to commence running.

#PBS -l walltime=24:00:00 amount of time that the job is allowed to run - in this case up to 24 hours. The maximum wall time is 7 days or 168 hours. Depending on the requested time to run the job it will be placed in the quick, small, large or huge queue.

Once the PBS Pro script is ready, now you can submit the job to the HPC as follows:

To see the progress of your job, type:

Alternatively:

 

Related content

nf-core/hic: Analysis of Chromosome Conformation Capture data (Hi-C)
nf-core/hic: Analysis of Chromosome Conformation Capture data (Hi-C)
Read with this
RNAseq - Star 2 pass approach (Ronin)
RNAseq - Star 2 pass approach (Ronin)
More like this
VSD-1.0 (Virus Surveillance and Diagnosis)
VSD-1.0 (Virus Surveillance and Diagnosis)
Read with this
Running BLAST sequence similarity
Running BLAST sequence similarity
More like this
ONT Oxford Nanopore fast5 processing
ONT Oxford Nanopore fast5 processing
Read with this
eResearch - Fetch miRBase resources
eResearch - Fetch miRBase resources
More like this