/
nf-core/ampliseq 16S amplicon analysis pipeline (NextFlow Ampliseq)

nf-core/ampliseq 16S amplicon analysis pipeline (NextFlow Ampliseq)

Overview

Nextflow is a pipeline engine that can take advantage of the batch nature of the HPC environment to efficiently and quickly run Bioinformatic workflows.

For more information about Nextflow, please visit Nextflow - A DSL for parallel and scalable computational pipelines

The ampliseq pipeline is a bioinformatics analysis pipeline used for 16S rRNA amplicon sequencing data. It combines multiple 16S analysis tools in a single pipeline, to produce a variety of statistical and quantitative outputs, that can be used in further analysis or in publications.

https://nf-co.re/ampliseq

https://github.com/nf-core/ampliseq

 

Installing NextFlow on your HPC account

NextFlow needs to be set up locally for each user account on the HPC. Instructions for installing and setting up NextFlow for your account are here:

NextFlow quick start

Follow the instructions in the above link, then when you have successfully run the NextFlow test (nextflow run hello generates Hello world!, etc), then run a test of the ampliseq pipeline (next section)

 

Running your NextFlow pipelines

NextFlow should never be run on the head node on the HPC (i.e. the node you are automatically logged on to) but should instead be run on a different node using the PBS job scheduler. For instructions on submitting PBS jobs, see here:

Running PBS jobs on the HPC Confluence page

Note: the wiki page for running PBS jobs is in development. Instead, run an interactive PBS session, as seen below in the ‘Alternative to submitting PBS job: interactive session.’ section

Directory structure

When a NextFlow pipeline is run, it generates multiple directories and output files. We therefore recommend you create a directory where you run all your NextFlow pipelines, so that you don’t have output directories and files scattered across your home directory.

This creates a ‘nextflow’ subdirectory in your home directory. You can then create individual subdirectories for each pipeline you run (e.g. cd nextflow, mkdir apliseq_test).

cd ~ mkdir nextflow

 

 

Alternative to submitting PBS job: interactive session.

Run tmux first, so job keeps running when you log off.

module load tmux tmux

Start an interactive PBS session:

qsub -I -S /bin/bash -l walltime=168:00:00 -l select=1:ncpus=4:mem=8gb

Then you can run all the following code.

 

Run an ampliseq test

This test is to see if NextFlow is installed correctly on your account and if you can run ampliseq. It uses a small built-in dataset to run ampliseq, running a full analysis and producing all the output directories and files.

If this test run fails, contact us at eResearch - eresearch@qut.edu.au - and we can examine the issue.

Note that running the test run on the HPC requires some additional steps to those listed on the ampliseq website. Primarily there are issues with ampliseq automatically downloading external files, so we need to download these locally, then change the ampliseq config file to point to these downloaded files.

 

Downloading test files

There are 3 files, or sets of files, that need to be downloaded first. The command to download each of these is included below.

First, go to your nextflow directory. We are assuming you called it ‘nextflow’ (see above ‘Running your NextFlow pipelines’ section for directory structure suggestions).

Go to your nextflow directory and create a subdirectory called ‘ampliseq_test’

Download the 3 required datafile sets:

1. The metadata file.

2. The taxonomic classifier file.

3. The test datafiles (fastq files). Note that the first line below is a very long one - it just adds all the datafile download paths to a test file, which can then be used in the wget command below it.

 

Ampliseq test config file

NextFlow pipelines have a series of default settings, which can be overridden by modifying a config file. The default config file for ampliseq points to downloadable datafile locations. As we’ve downloaded the datafiles locally, we need to modify the config file to point to these local files instead.

Make sure you are in the directory you created for this test (containing the downloaded test datafiles) - cd ~/nextflow/ampliseq_test

Load a text editor first. Nano will do.

Create and edit a ‘nextflow.config’ file

This will create and open an empty text file in nano. Into this file copy and paste the following:

In nano you can then save the file by ‘ctrl o’ and then exit nano with ‘ctrl x’

 

Ampliseq test command

Run the following command to test the ampliseq pipeline.

This will submit multiple PBS jobs, for each test file and analysis step. How fast this will run depends on how large the queue is for using the HPC. If there is no queue (rare) the test run will finish in approx 30 minutes. regardless, this does not need to be actively monitored. You can check later to see if the test run succeeded or failed. If it succeeded (you will see ‘Pipeline completed successfully’ message), continue with the analysis of your dataset. if it failed (multiple potential error messages), contact us at eResearch and we will work through the issue: eresearch@qut.edu.au.

You should see several output directories and files have been created in your ‘ampliseq_test’ directory. These contain the test analysis results. Have a look through these, as they are similar to the output from a full ampliseq run (i.e. on your dataset).

 

Ampliseq output

As can be seen in the test results (see above section), ampliseq produces a ‘results’ directory with several subdirectories, which contain various analyses outputs. These are outlined here:

https://nf-co.re/ampliseq/1.1.3/output

Briefly, these include quality control and a variety of taxonomic diversity and abundance analyses, using QIIME2 and DADA2 as core analysis tools.

These directories contain various tables and figures that can be used in either downstream analysis or directly in publications.

 

Running ampliseq on your dataset

In this section we will focus primarily on the commands and files you need to run the pipeline on your data. A complete description of the ampliseq pipeline is on the ampliseq websites. To properly understand the ampliseq processes and analysis outputs, it is advisable that you thoroughly read through these.

https://nf-co.re/ampliseq

https://github.com/nf-core/ampliseq

Ampliseq requires the creation of some additional files and modification of parameters files in order to run on your dataset. Instructions below.

 

Directory structure and files

Make sure you have created a subdirectory in your ‘nextflow’ directory. Give it a meaningful name (e.g. mkdir <yourprojectname>_nextflow. Make sure you are in that directory (cd ~/nextflow/<yourprojectname>_nextflow).

As with the test run, you will need to download some datafiles and create some new files (manifest file, metadata file, nextflow.config file) to get ampliseq running on the HPC.

NOTE: be very careful about the naming and structure of these files. Sample IDs in the manifest and metadata files must match exactly and the file paths need to be correct. Column names must be named exactly as in the examples below (including case). Spelling errors, a stray comma or other character in these files is one of the more common reasons for ampliseq to fail

 

Taxonomic database

Download the silva database. This is the main database ampliseq uses for taxonomic classification.

 

Manifest file

In the test run, a list of your filenames and the associated sample ID was included in the nextflow.config file. With many sample files it’s much easier to include this information in a separate manifest file.

This is a tab delimited file that contains 3 columns:

  1. ‘sampleID’, with the sample IDs. You can call these whatever you like, but it should be meaningful (e.g. groupA_1, groupA_2, groupb_1, groupB_2, etc)

  2. ‘forwardReads’. The full path for the forward reads. e.g. /home/myproject/fastq/sample1_S22_L001_R1.fastq.gz

  3. ‘reverseReads’. The full path for the forward reads. e.g. /home/myproject/fastq/sample1_S22_L001_R2.fastq.gz

This file can be created with Excel and then saved as a tab-delimited file (File → Save as → ‘manifest.txt’ → Text (Tab delimited)), then copied across to your NextFlow project directory (using WinSCP, Cyberduck, etc). Example:

sampleID

forwardReads

reverseReads

sampleID

forwardReads

reverseReads

groupA_1

/home/myproject/fastq/sample1_S22_L001_R1.fastq.gz

/home/myproject/fastq/sample1_S22_L001_R2.fastq.gz

groupA_2

/home/myproject/fastq/sample2_S23_L001_R1.fastq.gz

/home/myproject/fastq/sample2_S23_L001_R2.fastq.gz

etc…

 

 

 

Creating a manifest file at the command line

As mentioned above, spelling mistakes or extra characters in the file paths will cause ampliseq to fail. One way to avoid this is to generate the manifest file on the command line using the Linux tools awk and sed.

Below is an example of how to generate the manifest file. You may need to modify this, depending on how your files are named.

To create the manifest using awk, paste, sed:

  1. List all the fastq files in the directory (both read pairs)

2. List the sample IDs. If the sample names are in the sample files, they can be extracted using sed. For example:

The sample file names in this case are like such: ‘Raw8h_S10_L001_R1_001.fastq.gz’

The sample ID is ‘Raw8h’. The above sed command strips the characters after ‘_S’, leaving just the ID name. Depending on how your sample files are named, you can create a list of your sample IDs by modifying the above sed command.

3. Paste these together with the sample file directory prepended and tab delimiters. Output as ‘manifest.txt’.

Make sure you them manually add the 3 column names at the top of each column: ‘sampleID’, ‘forwardReads’ and ‘reverseReads’ (e.g. use a text editor like nano, or download the file and modify it in Excel, then re-upload it).

Finally, copy the created manifest.txt to the directory where you will be running ampliseq from.

 

Metadata file

This is a tab separated values file (.tsv) that is required by QIIME2 to compare taxonomic diversity with phenotype (e.g. how diversity varies per experimental treatment). It contains the same sample IDs found in the manifest file and a column for each category of metadata you have for the samples. This may include sequence barcodes, experimental treatment group (e.g. high fat vs low fat) and any other measurements taken, such as age, date collected, tissue type, sex, collection location, weight, length, etc, etc, etc). QIIME2 will compare every metadata column with taxonomic results, then calculate and plot correlations and diversity indices. See here for more details:

https://docs.qiime2.org/2019.10/tutorials/metadata/

To get a better idea of the structure and format of the metadata file, you can download an example file from here:

https://data.qiime2.org/2019.10/tutorials/moving-pictures/sample_metadata.tsv

This file can also be created in Excel and saved as a tab-delimited file. It can be any format, but .tsv is the default (File → Save as → ‘metadata.tsv’ → Text (Tab delimited))

 

nextflow.config file

Create a custom nextflow.config file

Edit the newly created ‘nextflow.config’ file to contain something like the following:

NOTE: This is an example nextflow.config file. Don’t simply copy and paste the above. You’ll need to modify it to reflect the primers you used to generate your sequences: FW_primer = and RV_primer =

The remaining lines can stay the same, presuming that you called your metadata file 'metadata.txt' and you have all the files in the directory where you will be running ampliseq from.

 

Notes on amplicon primers

There are multiple sets of amplicon primers, designed to amplify different regions of the 16S gene. You should be told by your sequencing company what these primers are.

The standard Ilumina protocol for 16S V3 and V4 region amplicons is here:

https://support.illumina.com/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf

Note the forward and reverse primers

16S Amplicon PCR Forward Primer = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG

16S Amplicon PCR Reverse Primer = 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC

These are not the primers you use in the nextflow.config file

These Illumina primers contain overhang sequences, that don’t anneal to any known DNA region:

Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]

Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]

The correct primers to use in your nextflow.config file are the 16S Amplicon primers with the overhang sequences removed.

I.e.

FW_primer = "CCTACGGGNGGCWGCAG"

RV_primer = "GACTACHVGGGTATCTAATCC"

Again, this is only for the Illumina 16S V3 and V4 region amplicons. If you’ve amplified a different region, you’ll need to provide different primers. If you’re using Illumina, look out for overhang sequences!

 

 

Running ampliseq on pacbio data

ampliseq is designed for paired-end Illumina data, but can be run on single-end pacbio data with a few modifications:

 

Manifest file

A paired-end manifest requires exactly ‘sampleID forwardReads reverseReads’ as column names.

For single end just use ‘sampleID Reads'.

See line 349 of the main.nf file for single_end samples: .map { row -> [ row.sampleID, file(row.Reads, checkIfExists: true) ] } compared to the default paired-end line: .map { row -> [ row.sampleID, [ file(row.forwardReads, checkIfExists: true), file(row.reverseReads, checkIfExists: true) ] ] }

https://github.com/nf-core/ampliseq/blob/master/main.nf

 

nextflow.config

Add a line ‘pacbio = true’

This tells ampliseq to run using single_end parameters and also changes some of the DADA2 parameters.

 

Running NextFlow’s ampliseq pipeline

 

Make sure Java is loaded (should be already loaded if you are continuing from the above steps, otherwise ‘module load java’) and that you have started an interactive PBS session (again, you should be in this if continuing from above)

Running the full pipeline may take a day or so, depending on how many people are using the HPC. If ampliseq fails for whatever reason (you’ll see red script and the error message in your console) it’s a good idea to resume the ampliseq run a couple of times, just to make sure it’s not a transitory error, which occurs sometimes. To do this, add --resume to the end of the command.

If ampliseq continues to fail after you have run --resume a couple of times, contact us at eResearch support: eresearch@qut.edu.au

 

Results

Ampliseq generates multiple output directories in a main ‘Results’ directory, including tables, figures, analysis results, etc. See here for details:

https://nf-co.re/ampliseq/1.1.3/output

 

These results can be used for further downstream analysis - for example plotting the table of taxon abundance - in Excel, R or other programs.

An example of how to analyse the results in R is here (in progress):

Downstream analysis of NextFlow ampliseq output (16S amplicon analysis)

 

 

 

 

 

Related content

Task 3: Run nf-core/rnaseq pipeline
Task 3: Run nf-core/rnaseq pipeline
More like this
Task 3 a: Run nf-core/rnaseq pipeline offline
Task 3 a: Run nf-core/rnaseq pipeline offline
More like this
Version 3.12.0
Version 3.12.0
More like this
nf-core/scrnaseq: A single-cell RNAseq pipeline for 10X genomics data
nf-core/scrnaseq: A single-cell RNAseq pipeline for 10X genomics data
More like this
6.2 Setting up working folders
6.2 Setting up working folders
More like this
2. Preparing working directory
2. Preparing working directory
More like this